Sample Detail

TitleMetagenomics of Fungi in Corals
DescriptionPCR Amplicons of Fungi inside Acropora Hyacinthus corals from American Samoa SampleID Sample Pool Size Clade2 Barcode 1 01AH 300 4 D GTCAGAGA 2 02AH 300 4 D TGACAGAG 3 03AH 300 4 D TTCCTACG 4 04AH 300 4 D TTGGTTGG 4 04AH 300 4 D AGGTGTAG 6 06AH 300 4 D AGGTTGCT 7 07AH 300 3 D CTCAAGTG 9 09AH 300 4 D CTCTTGTG 11 11AH 400 3 D ACTCACAG 12 12AH 400 4 D GATGCAAG 14 14AH 400 2.5 C GTACGTTG 15 15AH 400 2.5 C TCCATCCA 16 16AH 400 3 C AGCAGATG 17 17AH 400 3 MIX CTGACACA 20 20AH 400 4 D AGTGCAGA 23 23AH 300 2 D GTGAACAG 27 27AH 300 3 D TCTGTCTG 28 28AH 400 3 MIX GCTTCCTA 29 29AH 400 3 C TGCTCAAG 31 31AH 400 3 C TGGTGAAG 33 33AH 400 3 MIX CCATCCAT 40 40AH 400 4 C GTCAACTG 41 41AH 400 1 C CTAGTGGT 45 45AH 400 3 D CTCTTCAG 55 55AH 400 4 C TGTGTCAG 57 57AH 400 2 C AGGTGATG 74 74AH 300 2.5 D GTCTAGTG 75 75AH 300 3 D CATCACCT 76 76AH 300 o D TGGAAGGT 81 18AH 400 3 C TACCTTCG forward primer ccgccgaacttaagcatatcaata reverse primer CGATCGATTTGCACGTCAGA

Organism Info

Taxon ID57731
Common Name
Scientific Nameenvironmental samples
Anonymized Name
Individual Name