Example of metadata

The DRA metadata submission tool cannot describe technical reads (adapter, primer and barcode sequences). When sequencing data contain technical reads to be submitted, submitters need to create Experiment XML files and describe technical reads in the <SPOT_DESCRIPTOR>.

Experiment (Spot, Platform)*

454 single reads*

Read

Read composition

Read Index : 0 1
Read : TCAG ATAGAGTTGATCCTGGCTCAT……………
Base Coordinate : 1
5
80
Read Type : Adapter Forward

454 paired reads*

Read

Read composition

Read Index : 0 1 2 3
Read : TCAG ATAGAGT……………CCTGG TCGTAT……………TATTACG CTCAT……………
Base Coordinate : 1 5
Read Type : Adapter Forward Linker Forward

Illumina single reads*

Read

Read composition

Read Index : 0
Read : ATAGAGTTGATCCTGG……………CCTGGCTCA
Base Coordinate :
1
72
Read Type : Forward

Illumina paired reads*

Read

Read composition

Read Index : 0 1
Read : ATAGAGTTGATCCTGG…………… CCTGGCTCATCAGTTGAT……………
Base Coordinate : 1
101
200
Read Type : Forward Reverse

SOLiD single reads*

Read

Read composition

Read Index : 0
Read : TTGATCCTGG……………CGCTCA
Base Coordinate :
1
50
Read Type : Forward

SOLiD paired reads*

Read

Read composition

Read Index : 0 1
Read : ATCCTGG…………… CATCAGTTGAT……………
Base Coordinate : 1
26
50
Read Type : Forward Forward

Ion torrent single reads*

Read

Read composition

Read Index : 0
Read : AGCCGTATATAG……………CGTCAGAA
Base Coordinate :
1
(x)
Read Type : Forward

PacBio single reads (Standard sequencing)*

PacBio single reads (Circular consensus sequencing)*

Typical examples causing errors in data validation*

In the case of validation error, correct the metadata and re-upload data files after stopping validation process.

Reads having no application read*

Read

Read composition

Read Index : 0 1
Read : ATCCGG CATCAGTTGAT…………………………………………………
Base Coordinate : 1
7
50
Read Type : Primer Linker (should have at least one application)

Reads with inconsistent base coordinate*

Read 1

Read composition

Read Index : 0 1
Read : ATCCGG…………… CATCAG……………
Base Coordinate : 1
1 (should be > 1)
Read Type : Forward Reverse

Read 2

Read composition

Read Index : 0 1 2
Read : TCAG ATAGAGTTG……… TCGTATAACTTCGTATAATGTATGCTATACGAAGTT
Base Coordinate : 1 5 4 (should be > 5)
Read Type : Adapter Forward Reverse

Read 3

Read composition

Read Index : 0 1
Read : ATCCGGGTGTGTCATCAG CATCAG……………
Base Coordinate : 2 (should start at 1)
19
Read Type : Adapter Forward

Reads with relative order which cannot be specified*

Read

Read composition

Read Index : 0 1 2 3
Read : TCAG ATAGA…………… ………………… CTCAT…………………………………………………………
Base Coordinate : 1 5
Read Type : Adapter Forward Linker Forward (This forward cannot be specified)

Experiment (Pipeline)*

Example 1 of Experiment XML Pipeline*

Example 2 of Experiment XML Pipeline *