| Design Description | Oligonucleotides comprising the top and bottom strands of each barcode adapter and a common adapter were diluted (separately) in TE (50µM each) and annealed in a thermocycler (95°C, 2 min; ramp down to 25°C by 0.1°C/s; 25°C, 30 min; 4°C hold). Adapters were then quantified using an intercalating dye (picogreen; Invitrogen, Carlsbad, CA), diluted in water to 0.6 ng/µL, and 6 µL (3.6 ng) of each pair of adapters (barcode and common) was aliquoted into a 96-well PCR plate and dried down. DNA samples (100ng in a volume of 10 µL) were added to individual adapter-containing wells and plates were, again, dried. Samples (DNA plus adapters) were digested for 2 h at 75°C with ApeKI (New England Biolabs) in 20 µL volumes containing 1X NEB Buffer 3 and 3.6U ApeKI . Adapters were then ligated to sticky ends by adding 30 µL of a solution containing ligase buffer with ATP (1.66 X) and T4 ligase (640 cohesive end units) (New England Biolabs) to each well. Samples were incubated at 22°C for 1 h and heated to 65°C for 30 min to inactivate theT4 ligase. Sets of 48 or 96 digested DNA samples, each with a different barcode adapter, were combined (5µL each) and purified using a commercial kit (QIAquick PCR Purification Kit, Qiagen) according to the manufacturer’s instructions. DNA samples were eluted in a final volume of 50µL. Restriction fragments from each library were then amplified in 50µL volumes containing 2 µL pooled DNA fragments, 1X Taq Master Mix (New England Biolabs) and 25 pmol, each, of the following primers: (A) 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and (B) 5’-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT. These primers contained complementary sequences both for amplifying restriction fragments with ligated adapters, and for facilitating downstream sequencing (i.e., binding PCR products to oligonucleotides that coat the Illumina sequencing flow cell and priming DNA sequencing reactions). Temperature cycling consisted of 72°C for 5 min, 98°C for 30 s followed by 18 cycles of 98°C for 30 s, 65°C for 30 s, 72°C for 30 s with a final Taq extension step at 72°C for 5 min. These amplified sample pools constitute a sequencing “library”. Libraries were purified as above (except that the final elution volume is 30 µL) and 1 µL was loaded onto an Experion automated electrophoresis station (BioRad) for evaluation of fragment sizes. Libraries were considered suitable for sequencing if adapter dimers (~128 bp in length) were minimal or absent and the majority of other DNA fragments were between 170-350 bp. If adapter dimers were present in excess of 0.5% based on the Experion output, libraries were constructed again using a few DNA samples and decreasing adapter amounts. Once the appropriate quantity of adapters was empirically determined for a particular enzyme/species combination, no further adapter titration was necessary. Single-end sequencing (86 bp reads), one 48- or 96-plex library per flowcell channel, was performed on a Genome Analyzer II (Illumina, Inc.). See Bentley et al (2008) for details of the sequencing process and chemistry. The bar code of each sample in the multiplexing libraries is attached below. Each sequence read should start with C[A or T]GC. Lane barcode correct_sample 2 CTCC M0001 2 TGCA M0012 2 ACTA M0021 2 GTCT M0029 2 GAAT M0038 2 GCGT M0046 2 TGGC M0057 2 CGAT M0067 2 CTTGA M0080 2 TCACC M0090 2 CTAGC M0099 2 ACAAA M0113 2 TTCTC M0003 2 AGCCC M0013 2 GTATT M0022 2 CTGTA M0030 2 AGCAT M0039 2 ACTAT M0047 2 GAGAAT M0058 2 CCAGCT M0068 2 TTCAGA M0081 2 TAGGAA unknown 2 GCTCTA M0101 2 CCACAA M0114 2 CGTCAA M0005 2 CTTCCA M0014 2 GAGATA M0023 2 ATGCCT M0031 2 TATTTTT M0040 2 CTTGCTT M0048 2 ATGAAAC M0059 2 AAAAGTT M0071 2 GAATTCA M0082 2 GAACTTC M0092 2 GGACCTA M0102 2 GTCGATT M0116 2 AACGCCT M0007 2 AATATGC M0015 2 ACGACTAC M0024 2 AAGGATGC M0032 2 TAGCATGC M0041 2 TAGGAAGC M0051 2 TAGGCCAT M0060 2 TGCAAGGA M0074 2 TGGTACGT M0083 2 TCTCAGTC M0093 2 CCGGATAT M0105 2 CGCCTTAT M0118 3 CTCC M0008 3 TGCA M0016 3 ACTA M0025 3 GTCT M0033 3 GAAT M0042 3 GCGT M0052 3 TGGC M0061 3 CGAT M0075 3 CTTGA M0085 3 TCACC M0095 3 CTAGC M0106 3 ACAAA M0119 3 TTCTC M0009 3 AGCCC M0017 3 GTATT M0026 3 CTGTA M0034 3 AGCAT M0043 3 ACTAT M0054 3 GAGAAT M0062 3 CCAGCT M0076 3 TTCAGA M0086 3 TAGGAA M0096 3 GCTCTA M0109 3 CCACAA M0121 3 CGTCAA M0010 3 CTTCCA M0018 3 GAGATA M0027 3 ATGCCT M0035 3 TATTTTT M0044 3 CTTGCTT M0055 3 ATGAAAC M0063 3 AAAAGTT M0077 3 GAATTCA M0087 3 GAACTTC M0097 3 GGACCTA M0110 3 GTCGATT M0123 3 AACGCCT M0011 3 AATATGC M0019 3 ACGACTAC M0028 3 AAGGATGC M0036 3 TAGCATGC M0045 3 TAGGAAGC M0056 3 TAGGCCAT M0066 3 TGCAAGGA M0079 3 TGGTACGT M0088 3 TCTCAGTC M0098 3 CCGGATAT M0111 3 CGCCTTAT M0124 4 CTCC M0125 4 TGCA M0138 4 ACTA M0153 4 GTCT M0163 4 GAAT M0172 4 GCGT M0184 4 TGGC M0192 4 CGAT M0202 4 CTTGA M0218 4 TCACC M0229 4 CTAGC M0246 4 ACAAA M0263 4 TTCTC M0126 4 AGCCC M0141 4 GTATT M0154 4 CTGTA M0164 4 AGCAT M0175 4 ACTAT M0185 4 GAGAAT M0194 4 CCAGCT M0204 4 TTCAGA M0219 4 TAGGAA M0233 4 GCTCTA M0248 4 CCACAA M0264 4 CGTCAA M0127 4 CTTCCA M0142 4 GAGATA M0156 4 ATGCCT M0165 4 TATTTTT M0176 4 CTTGCTT M0186 4 ATGAAAC M0195 4 AAAAGTT M0205 4 GAATTCA M0220 4 GAACTTC M0236 4 GGACCTA M0250 4 GTCGATT M0265 4 AACGCCT M0129 4 AATATGC M0143 4 ACGACTAC M0157 4 AAGGATGC M0167 4 TAGCATGC M0177 4 TAGGAAGC M0187 4 TAGGCCAT M0196 4 TGCAAGGA M0209 4 TGGTACGT M0222 4 TCTCAGTC M0237 4 CCGGATAT M0253 4 CGCCTTAT M0266 5 CTCC M0130 5 TGCA M0145 5 ACTA M0159 5 GTCT M0168 5 GAAT M0180 5 GCGT M0188 5 TGGC M0197 5 CGAT M0210 5 CTTGA M0223 5 TCACC M0238 5 CTAGC M0255 5 ACAAA M0267 5 TTCTC M0131 5 AGCCC M0146 5 GTATT M0160 5 CTGTA M0169 5 AGCAT M0181 5 ACTAT M0189 5 GAGAAT M0198 5 CCAGCT M0213 5 TTCAGA M0224 5 TAGGAA M0240 5 GCTCTA M0256 5 CCACAA M0268 5 CGTCAA M0132(mix) 5 CTTCCA empty 5 GAGATA M0161 5 ATGCCT M0170 5 TATTTTT M0182 5 CTTGCTT M0190 5 ATGAAAC M0199 5 AAAAGTT M0215 5 GAATTCA M0225 5 GAACTTC M0241 5 GGACCTA M0258 5 GTCGATT M0269 5 AACGCCT M0133 5 AATATGC M0152 5 ACGACTAC M0162 5 AAGGATGC M0171 5 TAGCATGC M0183 5 TAGGAAGC M0191 5 TAGGCCAT M0200 5 TGCAAGGA M0216 5 TGGTACGT M0228 5 TCTCAGTC M0244 5 CCGGATAT M0262 5 CGCCTTAT M0270 6 CTCC M0271 6 TGCA M0280 6 ACTA M0292 6 GTCT M0303 6 GAAT M0313 6 GCGT M0322 6 TGGC M0334 6 CGAT M0344 6 CTTGA M0354 6 TCACC M0366 6 CTAGC M0379 6 ACAAA empty 6 TTCTC M0272 6 AGCCC M0281 6 GTATT M0295 6 CTGTA M0304 6 AGCAT M0314 6 ACTAT M0323 6 GAGAAT M0335 6 CCAGCT M0345 6 TTCAGA M0355 6 TAGGAA M0367 6 GCTCTA M0380 6 CCACAA empty 6 CGTCAA M0274 6 CTTCCA M0283 6 GAGATA M0296 6 ATGCCT M0305 6 TATTTTT M0315 6 CTTGCTT M0325 6 ATGAAAC M0336 6 AAAAGTT M0346 6 GAATTCA M0356 6 GAACTTC M0368 6 GGACCTA M0381 6 GTCGATT empty 6 AACGCCT M0275 6 AATATGC M0284 6 ACGACTAC M0297 6 AAGGATGC M0307 6 TAGCATGC M0317 6 TAGGAAGC M0326 6 TAGGCCAT M0337 6 TGCAAGGA M0347 6 TGGTACGT M0357 6 TCTCAGTC M0369 6 CCGGATAT M0382 6 CGCCTTAT empty 7 CTCC M0276 7 TGCA M0286 7 ACTA M0298 7 GTCT M0308 7 GAAT M0318 7 GCGT M0327 7 TGGC M0338 7 CGAT M0349 7 CTTGA M0360 7 TCACC M0373 7 CTAGC M0383 7 ACAAA empty 7 TTCTC M0277 7 AGCCC M0287 7 GTATT M0300 7 CTGTA M0309 7 AGCAT M0319 7 ACTAT M0328 7 GAGAAT M0340 7 CCAGCT M0351 7 TTCAGA M0362 7 TAGGAA M0374 7 GCTCTA M0384 7 CCACAA empty 7 CGTCAA M0278 7 CTTCCA M0288 7 GAGATA M0301 7 ATGCCT M0310 7 TATTTTT M0320 7 CTTGCTT M0329 7 ATGAAAC M0341 7 AAAAGTT M0352 7 GAATTCA M0364 7 GAACTTC M0376 7 GGACCTA empty 7 GTCGATT empty 7 AACGCCT M0279 7 AATATGC M0289 7 ACGACTAC M0302 7 AAGGATGC M0311 7 TAGCATGC M0321 7 TAGGAAGC M0331 7 TAGGCCAT M0342 7 TGCAAGGA M0353 7 TGGTACGT M0365 7 TCTCAGTC M0378 7 CCGGATAT empty 7 CGCCTTAT empty |
